Review



10182 recombinant human egf perprotech cat  (MedChemExpress)


Bioz Verified Symbol MedChemExpress is a verified supplier
Bioz Manufacturer Symbol MedChemExpress manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    MedChemExpress 10182 recombinant human egf perprotech cat
    10182 Recombinant Human Egf Perprotech Cat, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 99/100, based on 453 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/10182+recombinant+human+egf+perprotech+cat/Laduviglusib/pm41707653-275-42-41
    Average 99 stars, based on 453 article reviews
    10182 recombinant human egf perprotech cat - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: A human patient-derived organoid biobank to model tumor heterogeneity and therapeutic vulnerability for oral squamous cell carcinoma.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER N-2 Supplement Thermo Fisher Scientific Cat#17502048 Recombinant Human FGF10 PerproTech Cat#HY-P7048 Recombinant Human FGF2 PerproTech Cat#HY-P7330 Recombinant Human R-spondin 1 MedChemExpress Cat#HY-112484 Noggin PerproTech Cat#120-10C-5UG A83-01 MedChemExpress Cat#HY-10432 Forskolin MedChemExpress Cat#HY-15371 Prostaglandin E2 MedChemExpress Cat#HY-101952 CHIR99021 MedChemExpress CatHY-10182 Recombinant Human EGF PerproTech Cat#AF-100-15 Wnt3a MedChemExpress Cat#HY-P70453C GA-017 MedChemExpress Cat#HY-147082 Matrigel Corning Cat#356231 Cell Recovery Solution Corning Cat#354253 Organoid Cryopreservation Medium BioGenous Cat#E238023 Y-27632 MedChemExpress Cat#HY-10071 Cisplatin MedChemExpress Cat#HY-17394 Cetuximab Selleck Cat#A2000 Docetaxel MedChemExpress Cat#HY-B0011 LiCl MedChemExpress Cat#HY-Y0649 8-Isopentenylnaringenin (8-PN) Enzo Life Cat# ALX-385-025 Critical commercial assays TUNEL apoptosis detection kit Vazyme Cat#A113 CellTiter-Glo® 3D Cell Viability Assay Promega Cat#G9681 Deposited data Data files for RNA-seq and WES This study GSA: HRA011280 Oligonucleotides shRNA sequence for CDCP1 (5 ′ -3 ′ ): GCTCTGCCACGAGAAAGCAACATTA This study N/A shRNA sequence for FOSL1 (5 ′ -3 ′ ): CTGTACCTTGTATCTCCCTTT This study N/A Control shRNA sequence (5 ′ -3 ′ ): TTCTCCGAACGTGTCACGT This study N/A siRNA1 sequence for CDCP1 (5 ′ -3 ′ ): UAAUGUUGCUUUCUCGUGGCAGAGC This study N/A siRNA2 sequence for CDCP1 (5 ′ -3 ′ ): AUAGAUGAGCGGUUUGCAAUGCUGA This study N/A Control siRNA sequence (5 ′ -3 ′ ): UUCUCCGAACGUGUCACGUUU This study N/A Software and algorithms FlowJo FlowJo Software https://www.flowjo.com GraphPad Prism GraphPad Software https://www.graphpad.com ImageJ ImageJ Software https://imagej.net/ij/ RStudio RStudio Software https://www.rstudio.com/ Cell Reports Medicine 7, 102622, February 17, 2026 e2 Medical University from 2022 to 2024. ..

    Cell Recovery:

    Article Title: A human patient-derived organoid biobank to model tumor heterogeneity and therapeutic vulnerability for oral squamous cell carcinoma.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER N-2 Supplement Thermo Fisher Scientific Cat#17502048 Recombinant Human FGF10 PerproTech Cat#HY-P7048 Recombinant Human FGF2 PerproTech Cat#HY-P7330 Recombinant Human R-spondin 1 MedChemExpress Cat#HY-112484 Noggin PerproTech Cat#120-10C-5UG A83-01 MedChemExpress Cat#HY-10432 Forskolin MedChemExpress Cat#HY-15371 Prostaglandin E2 MedChemExpress Cat#HY-101952 CHIR99021 MedChemExpress CatHY-10182 Recombinant Human EGF PerproTech Cat#AF-100-15 Wnt3a MedChemExpress Cat#HY-P70453C GA-017 MedChemExpress Cat#HY-147082 Matrigel Corning Cat#356231 Cell Recovery Solution Corning Cat#354253 Organoid Cryopreservation Medium BioGenous Cat#E238023 Y-27632 MedChemExpress Cat#HY-10071 Cisplatin MedChemExpress Cat#HY-17394 Cetuximab Selleck Cat#A2000 Docetaxel MedChemExpress Cat#HY-B0011 LiCl MedChemExpress Cat#HY-Y0649 8-Isopentenylnaringenin (8-PN) Enzo Life Cat# ALX-385-025 Critical commercial assays TUNEL apoptosis detection kit Vazyme Cat#A113 CellTiter-Glo® 3D Cell Viability Assay Promega Cat#G9681 Deposited data Data files for RNA-seq and WES This study GSA: HRA011280 Oligonucleotides shRNA sequence for CDCP1 (5 ′ -3 ′ ): GCTCTGCCACGAGAAAGCAACATTA This study N/A shRNA sequence for FOSL1 (5 ′ -3 ′ ): CTGTACCTTGTATCTCCCTTT This study N/A Control shRNA sequence (5 ′ -3 ′ ): TTCTCCGAACGTGTCACGT This study N/A siRNA1 sequence for CDCP1 (5 ′ -3 ′ ): UAAUGUUGCUUUCUCGUGGCAGAGC This study N/A siRNA2 sequence for CDCP1 (5 ′ -3 ′ ): AUAGAUGAGCGGUUUGCAAUGCUGA This study N/A Control siRNA sequence (5 ′ -3 ′ ): UUCUCCGAACGUGUCACGUUU This study N/A Software and algorithms FlowJo FlowJo Software https://www.flowjo.com GraphPad Prism GraphPad Software https://www.graphpad.com ImageJ ImageJ Software https://imagej.net/ij/ RStudio RStudio Software https://www.rstudio.com/ Cell Reports Medicine 7, 102622, February 17, 2026 e2 Medical University from 2022 to 2024. ..

    TUNEL Assay:

    Article Title: A human patient-derived organoid biobank to model tumor heterogeneity and therapeutic vulnerability for oral squamous cell carcinoma.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER N-2 Supplement Thermo Fisher Scientific Cat#17502048 Recombinant Human FGF10 PerproTech Cat#HY-P7048 Recombinant Human FGF2 PerproTech Cat#HY-P7330 Recombinant Human R-spondin 1 MedChemExpress Cat#HY-112484 Noggin PerproTech Cat#120-10C-5UG A83-01 MedChemExpress Cat#HY-10432 Forskolin MedChemExpress Cat#HY-15371 Prostaglandin E2 MedChemExpress Cat#HY-101952 CHIR99021 MedChemExpress CatHY-10182 Recombinant Human EGF PerproTech Cat#AF-100-15 Wnt3a MedChemExpress Cat#HY-P70453C GA-017 MedChemExpress Cat#HY-147082 Matrigel Corning Cat#356231 Cell Recovery Solution Corning Cat#354253 Organoid Cryopreservation Medium BioGenous Cat#E238023 Y-27632 MedChemExpress Cat#HY-10071 Cisplatin MedChemExpress Cat#HY-17394 Cetuximab Selleck Cat#A2000 Docetaxel MedChemExpress Cat#HY-B0011 LiCl MedChemExpress Cat#HY-Y0649 8-Isopentenylnaringenin (8-PN) Enzo Life Cat# ALX-385-025 Critical commercial assays TUNEL apoptosis detection kit Vazyme Cat#A113 CellTiter-Glo® 3D Cell Viability Assay Promega Cat#G9681 Deposited data Data files for RNA-seq and WES This study GSA: HRA011280 Oligonucleotides shRNA sequence for CDCP1 (5 ′ -3 ′ ): GCTCTGCCACGAGAAAGCAACATTA This study N/A shRNA sequence for FOSL1 (5 ′ -3 ′ ): CTGTACCTTGTATCTCCCTTT This study N/A Control shRNA sequence (5 ′ -3 ′ ): TTCTCCGAACGTGTCACGT This study N/A siRNA1 sequence for CDCP1 (5 ′ -3 ′ ): UAAUGUUGCUUUCUCGUGGCAGAGC This study N/A siRNA2 sequence for CDCP1 (5 ′ -3 ′ ): AUAGAUGAGCGGUUUGCAAUGCUGA This study N/A Control siRNA sequence (5 ′ -3 ′ ): UUCUCCGAACGUGUCACGUUU This study N/A Software and algorithms FlowJo FlowJo Software https://www.flowjo.com GraphPad Prism GraphPad Software https://www.graphpad.com ImageJ ImageJ Software https://imagej.net/ij/ RStudio RStudio Software https://www.rstudio.com/ Cell Reports Medicine 7, 102622, February 17, 2026 e2 Medical University from 2022 to 2024. ..

    Viability Assay:

    Article Title: A human patient-derived organoid biobank to model tumor heterogeneity and therapeutic vulnerability for oral squamous cell carcinoma.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER N-2 Supplement Thermo Fisher Scientific Cat#17502048 Recombinant Human FGF10 PerproTech Cat#HY-P7048 Recombinant Human FGF2 PerproTech Cat#HY-P7330 Recombinant Human R-spondin 1 MedChemExpress Cat#HY-112484 Noggin PerproTech Cat#120-10C-5UG A83-01 MedChemExpress Cat#HY-10432 Forskolin MedChemExpress Cat#HY-15371 Prostaglandin E2 MedChemExpress Cat#HY-101952 CHIR99021 MedChemExpress CatHY-10182 Recombinant Human EGF PerproTech Cat#AF-100-15 Wnt3a MedChemExpress Cat#HY-P70453C GA-017 MedChemExpress Cat#HY-147082 Matrigel Corning Cat#356231 Cell Recovery Solution Corning Cat#354253 Organoid Cryopreservation Medium BioGenous Cat#E238023 Y-27632 MedChemExpress Cat#HY-10071 Cisplatin MedChemExpress Cat#HY-17394 Cetuximab Selleck Cat#A2000 Docetaxel MedChemExpress Cat#HY-B0011 LiCl MedChemExpress Cat#HY-Y0649 8-Isopentenylnaringenin (8-PN) Enzo Life Cat# ALX-385-025 Critical commercial assays TUNEL apoptosis detection kit Vazyme Cat#A113 CellTiter-Glo® 3D Cell Viability Assay Promega Cat#G9681 Deposited data Data files for RNA-seq and WES This study GSA: HRA011280 Oligonucleotides shRNA sequence for CDCP1 (5 ′ -3 ′ ): GCTCTGCCACGAGAAAGCAACATTA This study N/A shRNA sequence for FOSL1 (5 ′ -3 ′ ): CTGTACCTTGTATCTCCCTTT This study N/A Control shRNA sequence (5 ′ -3 ′ ): TTCTCCGAACGTGTCACGT This study N/A siRNA1 sequence for CDCP1 (5 ′ -3 ′ ): UAAUGUUGCUUUCUCGUGGCAGAGC This study N/A siRNA2 sequence for CDCP1 (5 ′ -3 ′ ): AUAGAUGAGCGGUUUGCAAUGCUGA This study N/A Control siRNA sequence (5 ′ -3 ′ ): UUCUCCGAACGUGUCACGUUU This study N/A Software and algorithms FlowJo FlowJo Software https://www.flowjo.com GraphPad Prism GraphPad Software https://www.graphpad.com ImageJ ImageJ Software https://imagej.net/ij/ RStudio RStudio Software https://www.rstudio.com/ Cell Reports Medicine 7, 102622, February 17, 2026 e2 Medical University from 2022 to 2024. ..

    RNA Sequencing:

    Article Title: A human patient-derived organoid biobank to model tumor heterogeneity and therapeutic vulnerability for oral squamous cell carcinoma.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER N-2 Supplement Thermo Fisher Scientific Cat#17502048 Recombinant Human FGF10 PerproTech Cat#HY-P7048 Recombinant Human FGF2 PerproTech Cat#HY-P7330 Recombinant Human R-spondin 1 MedChemExpress Cat#HY-112484 Noggin PerproTech Cat#120-10C-5UG A83-01 MedChemExpress Cat#HY-10432 Forskolin MedChemExpress Cat#HY-15371 Prostaglandin E2 MedChemExpress Cat#HY-101952 CHIR99021 MedChemExpress CatHY-10182 Recombinant Human EGF PerproTech Cat#AF-100-15 Wnt3a MedChemExpress Cat#HY-P70453C GA-017 MedChemExpress Cat#HY-147082 Matrigel Corning Cat#356231 Cell Recovery Solution Corning Cat#354253 Organoid Cryopreservation Medium BioGenous Cat#E238023 Y-27632 MedChemExpress Cat#HY-10071 Cisplatin MedChemExpress Cat#HY-17394 Cetuximab Selleck Cat#A2000 Docetaxel MedChemExpress Cat#HY-B0011 LiCl MedChemExpress Cat#HY-Y0649 8-Isopentenylnaringenin (8-PN) Enzo Life Cat# ALX-385-025 Critical commercial assays TUNEL apoptosis detection kit Vazyme Cat#A113 CellTiter-Glo® 3D Cell Viability Assay Promega Cat#G9681 Deposited data Data files for RNA-seq and WES This study GSA: HRA011280 Oligonucleotides shRNA sequence for CDCP1 (5 ′ -3 ′ ): GCTCTGCCACGAGAAAGCAACATTA This study N/A shRNA sequence for FOSL1 (5 ′ -3 ′ ): CTGTACCTTGTATCTCCCTTT This study N/A Control shRNA sequence (5 ′ -3 ′ ): TTCTCCGAACGTGTCACGT This study N/A siRNA1 sequence for CDCP1 (5 ′ -3 ′ ): UAAUGUUGCUUUCUCGUGGCAGAGC This study N/A siRNA2 sequence for CDCP1 (5 ′ -3 ′ ): AUAGAUGAGCGGUUUGCAAUGCUGA This study N/A Control siRNA sequence (5 ′ -3 ′ ): UUCUCCGAACGUGUCACGUUU This study N/A Software and algorithms FlowJo FlowJo Software https://www.flowjo.com GraphPad Prism GraphPad Software https://www.graphpad.com ImageJ ImageJ Software https://imagej.net/ij/ RStudio RStudio Software https://www.rstudio.com/ Cell Reports Medicine 7, 102622, February 17, 2026 e2 Medical University from 2022 to 2024. ..

    shRNA:

    Article Title: A human patient-derived organoid biobank to model tumor heterogeneity and therapeutic vulnerability for oral squamous cell carcinoma.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER N-2 Supplement Thermo Fisher Scientific Cat#17502048 Recombinant Human FGF10 PerproTech Cat#HY-P7048 Recombinant Human FGF2 PerproTech Cat#HY-P7330 Recombinant Human R-spondin 1 MedChemExpress Cat#HY-112484 Noggin PerproTech Cat#120-10C-5UG A83-01 MedChemExpress Cat#HY-10432 Forskolin MedChemExpress Cat#HY-15371 Prostaglandin E2 MedChemExpress Cat#HY-101952 CHIR99021 MedChemExpress CatHY-10182 Recombinant Human EGF PerproTech Cat#AF-100-15 Wnt3a MedChemExpress Cat#HY-P70453C GA-017 MedChemExpress Cat#HY-147082 Matrigel Corning Cat#356231 Cell Recovery Solution Corning Cat#354253 Organoid Cryopreservation Medium BioGenous Cat#E238023 Y-27632 MedChemExpress Cat#HY-10071 Cisplatin MedChemExpress Cat#HY-17394 Cetuximab Selleck Cat#A2000 Docetaxel MedChemExpress Cat#HY-B0011 LiCl MedChemExpress Cat#HY-Y0649 8-Isopentenylnaringenin (8-PN) Enzo Life Cat# ALX-385-025 Critical commercial assays TUNEL apoptosis detection kit Vazyme Cat#A113 CellTiter-Glo® 3D Cell Viability Assay Promega Cat#G9681 Deposited data Data files for RNA-seq and WES This study GSA: HRA011280 Oligonucleotides shRNA sequence for CDCP1 (5 ′ -3 ′ ): GCTCTGCCACGAGAAAGCAACATTA This study N/A shRNA sequence for FOSL1 (5 ′ -3 ′ ): CTGTACCTTGTATCTCCCTTT This study N/A Control shRNA sequence (5 ′ -3 ′ ): TTCTCCGAACGTGTCACGT This study N/A siRNA1 sequence for CDCP1 (5 ′ -3 ′ ): UAAUGUUGCUUUCUCGUGGCAGAGC This study N/A siRNA2 sequence for CDCP1 (5 ′ -3 ′ ): AUAGAUGAGCGGUUUGCAAUGCUGA This study N/A Control siRNA sequence (5 ′ -3 ′ ): UUCUCCGAACGUGUCACGUUU This study N/A Software and algorithms FlowJo FlowJo Software https://www.flowjo.com GraphPad Prism GraphPad Software https://www.graphpad.com ImageJ ImageJ Software https://imagej.net/ij/ RStudio RStudio Software https://www.rstudio.com/ Cell Reports Medicine 7, 102622, February 17, 2026 e2 Medical University from 2022 to 2024. ..

    Sequencing:

    Article Title: A human patient-derived organoid biobank to model tumor heterogeneity and therapeutic vulnerability for oral squamous cell carcinoma.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER N-2 Supplement Thermo Fisher Scientific Cat#17502048 Recombinant Human FGF10 PerproTech Cat#HY-P7048 Recombinant Human FGF2 PerproTech Cat#HY-P7330 Recombinant Human R-spondin 1 MedChemExpress Cat#HY-112484 Noggin PerproTech Cat#120-10C-5UG A83-01 MedChemExpress Cat#HY-10432 Forskolin MedChemExpress Cat#HY-15371 Prostaglandin E2 MedChemExpress Cat#HY-101952 CHIR99021 MedChemExpress CatHY-10182 Recombinant Human EGF PerproTech Cat#AF-100-15 Wnt3a MedChemExpress Cat#HY-P70453C GA-017 MedChemExpress Cat#HY-147082 Matrigel Corning Cat#356231 Cell Recovery Solution Corning Cat#354253 Organoid Cryopreservation Medium BioGenous Cat#E238023 Y-27632 MedChemExpress Cat#HY-10071 Cisplatin MedChemExpress Cat#HY-17394 Cetuximab Selleck Cat#A2000 Docetaxel MedChemExpress Cat#HY-B0011 LiCl MedChemExpress Cat#HY-Y0649 8-Isopentenylnaringenin (8-PN) Enzo Life Cat# ALX-385-025 Critical commercial assays TUNEL apoptosis detection kit Vazyme Cat#A113 CellTiter-Glo® 3D Cell Viability Assay Promega Cat#G9681 Deposited data Data files for RNA-seq and WES This study GSA: HRA011280 Oligonucleotides shRNA sequence for CDCP1 (5 ′ -3 ′ ): GCTCTGCCACGAGAAAGCAACATTA This study N/A shRNA sequence for FOSL1 (5 ′ -3 ′ ): CTGTACCTTGTATCTCCCTTT This study N/A Control shRNA sequence (5 ′ -3 ′ ): TTCTCCGAACGTGTCACGT This study N/A siRNA1 sequence for CDCP1 (5 ′ -3 ′ ): UAAUGUUGCUUUCUCGUGGCAGAGC This study N/A siRNA2 sequence for CDCP1 (5 ′ -3 ′ ): AUAGAUGAGCGGUUUGCAAUGCUGA This study N/A Control siRNA sequence (5 ′ -3 ′ ): UUCUCCGAACGUGUCACGUUU This study N/A Software and algorithms FlowJo FlowJo Software https://www.flowjo.com GraphPad Prism GraphPad Software https://www.graphpad.com ImageJ ImageJ Software https://imagej.net/ij/ RStudio RStudio Software https://www.rstudio.com/ Cell Reports Medicine 7, 102622, February 17, 2026 e2 Medical University from 2022 to 2024. ..

    Control:

    Article Title: A human patient-derived organoid biobank to model tumor heterogeneity and therapeutic vulnerability for oral squamous cell carcinoma.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER N-2 Supplement Thermo Fisher Scientific Cat#17502048 Recombinant Human FGF10 PerproTech Cat#HY-P7048 Recombinant Human FGF2 PerproTech Cat#HY-P7330 Recombinant Human R-spondin 1 MedChemExpress Cat#HY-112484 Noggin PerproTech Cat#120-10C-5UG A83-01 MedChemExpress Cat#HY-10432 Forskolin MedChemExpress Cat#HY-15371 Prostaglandin E2 MedChemExpress Cat#HY-101952 CHIR99021 MedChemExpress CatHY-10182 Recombinant Human EGF PerproTech Cat#AF-100-15 Wnt3a MedChemExpress Cat#HY-P70453C GA-017 MedChemExpress Cat#HY-147082 Matrigel Corning Cat#356231 Cell Recovery Solution Corning Cat#354253 Organoid Cryopreservation Medium BioGenous Cat#E238023 Y-27632 MedChemExpress Cat#HY-10071 Cisplatin MedChemExpress Cat#HY-17394 Cetuximab Selleck Cat#A2000 Docetaxel MedChemExpress Cat#HY-B0011 LiCl MedChemExpress Cat#HY-Y0649 8-Isopentenylnaringenin (8-PN) Enzo Life Cat# ALX-385-025 Critical commercial assays TUNEL apoptosis detection kit Vazyme Cat#A113 CellTiter-Glo® 3D Cell Viability Assay Promega Cat#G9681 Deposited data Data files for RNA-seq and WES This study GSA: HRA011280 Oligonucleotides shRNA sequence for CDCP1 (5 ′ -3 ′ ): GCTCTGCCACGAGAAAGCAACATTA This study N/A shRNA sequence for FOSL1 (5 ′ -3 ′ ): CTGTACCTTGTATCTCCCTTT This study N/A Control shRNA sequence (5 ′ -3 ′ ): TTCTCCGAACGTGTCACGT This study N/A siRNA1 sequence for CDCP1 (5 ′ -3 ′ ): UAAUGUUGCUUUCUCGUGGCAGAGC This study N/A siRNA2 sequence for CDCP1 (5 ′ -3 ′ ): AUAGAUGAGCGGUUUGCAAUGCUGA This study N/A Control siRNA sequence (5 ′ -3 ′ ): UUCUCCGAACGUGUCACGUUU This study N/A Software and algorithms FlowJo FlowJo Software https://www.flowjo.com GraphPad Prism GraphPad Software https://www.graphpad.com ImageJ ImageJ Software https://imagej.net/ij/ RStudio RStudio Software https://www.rstudio.com/ Cell Reports Medicine 7, 102622, February 17, 2026 e2 Medical University from 2022 to 2024. ..

    Software:

    Article Title: A human patient-derived organoid biobank to model tumor heterogeneity and therapeutic vulnerability for oral squamous cell carcinoma.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER N-2 Supplement Thermo Fisher Scientific Cat#17502048 Recombinant Human FGF10 PerproTech Cat#HY-P7048 Recombinant Human FGF2 PerproTech Cat#HY-P7330 Recombinant Human R-spondin 1 MedChemExpress Cat#HY-112484 Noggin PerproTech Cat#120-10C-5UG A83-01 MedChemExpress Cat#HY-10432 Forskolin MedChemExpress Cat#HY-15371 Prostaglandin E2 MedChemExpress Cat#HY-101952 CHIR99021 MedChemExpress CatHY-10182 Recombinant Human EGF PerproTech Cat#AF-100-15 Wnt3a MedChemExpress Cat#HY-P70453C GA-017 MedChemExpress Cat#HY-147082 Matrigel Corning Cat#356231 Cell Recovery Solution Corning Cat#354253 Organoid Cryopreservation Medium BioGenous Cat#E238023 Y-27632 MedChemExpress Cat#HY-10071 Cisplatin MedChemExpress Cat#HY-17394 Cetuximab Selleck Cat#A2000 Docetaxel MedChemExpress Cat#HY-B0011 LiCl MedChemExpress Cat#HY-Y0649 8-Isopentenylnaringenin (8-PN) Enzo Life Cat# ALX-385-025 Critical commercial assays TUNEL apoptosis detection kit Vazyme Cat#A113 CellTiter-Glo® 3D Cell Viability Assay Promega Cat#G9681 Deposited data Data files for RNA-seq and WES This study GSA: HRA011280 Oligonucleotides shRNA sequence for CDCP1 (5 ′ -3 ′ ): GCTCTGCCACGAGAAAGCAACATTA This study N/A shRNA sequence for FOSL1 (5 ′ -3 ′ ): CTGTACCTTGTATCTCCCTTT This study N/A Control shRNA sequence (5 ′ -3 ′ ): TTCTCCGAACGTGTCACGT This study N/A siRNA1 sequence for CDCP1 (5 ′ -3 ′ ): UAAUGUUGCUUUCUCGUGGCAGAGC This study N/A siRNA2 sequence for CDCP1 (5 ′ -3 ′ ): AUAGAUGAGCGGUUUGCAAUGCUGA This study N/A Control siRNA sequence (5 ′ -3 ′ ): UUCUCCGAACGUGUCACGUUU This study N/A Software and algorithms FlowJo FlowJo Software https://www.flowjo.com GraphPad Prism GraphPad Software https://www.graphpad.com ImageJ ImageJ Software https://imagej.net/ij/ RStudio RStudio Software https://www.rstudio.com/ Cell Reports Medicine 7, 102622, February 17, 2026 e2 Medical University from 2022 to 2024. ..



    Similar Products

    10182 recombinant human egf perprotech cat  (MedChemExpress)
    99
    MedChemExpress 10182 recombinant human egf perprotech cat
    10182 Recombinant Human Egf Perprotech Cat, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/10182+recombinant+human+egf+perprotech+cat/Laduviglusib/pm41707653-275-42-41
    Average 99 stars, based on 1 article reviews
    10182 recombinant human egf perprotech cat - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier

    Image Search Results